curly25 curly25
  • 03-10-2018
  • Social Studies
contestada

Why is the Latin language important to medicine and law

Respuesta :

cortneycarnaha
cortneycarnaha cortneycarnaha
  • 03-10-2018

Students who study Latin develop an interest in words. They learn something they had never thought of before. ... So, Latin is the next step after phonics because it continues the study of the Latin half of English vocabulary in a systematic, orderly way. Skip the vocabulary courses. Latin was an one of the original medical and law languages.


I hope it helps somehow.

Answer Link

Otras preguntas

Rewrite 2x+5y=3 using function notation​
16 oz jar of Peanut Butter for $2.49 or 64 oz jar of Peanut Butter $6.99?
Sleep is a essential part of life
At what point do the lines y = 6x – 18 and y=8x – 32 intersect?
What is an example of a square root function? In (,) form
Which of the following is NOT a feature of asexual reproduction? *
Which document expresses that people are entitled to the free exercise of religion? A. the English Bill of Rights B. the Mayflower Compact the Virginia Declarat
What process and type of resulting cells are represented in the diagram below?* D с A 00 R KK RX 13 MX xH
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
⚠️⚠️⚠️⚠️⚠️HELP HELP HELP HELP PLEASEEEE I HAVE 7 MINUTES LEFT ⚠️⚠️⚠️⚠️⚠️