KAYLAJ1713 KAYLAJ1713

04-10-2016
Mathematics

contestada

how to find the perimeter of a polygon

Respuesta :

05-10-2016

You would add up the sides to get the perimeter of a polygon.

Answer Link

Otras preguntas

Compare and contrast the narrator’s point of view at the beginning to the end of the story. Note any differences and the possible causes behind these difference

Create an expression equivalent to 4(2x−3)−6x+7 using the least number of terms.

Gavin invested $40,000 in the Jason and Kelly Partnership for ownership equity of $40,000. Prior to the investment, land was revalued to a market value of $363,

Which of the following is correct? The break-even point occurs when: total contribution margin equals total fixed expenses. total NOI equals total expenses. tot

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Suppose that an individual has a body fat percentage of 17.8% and weighs 152 pounds. How many pounds of his weight is made up of fat? Round your answer to the

Why is the cloning of Dolly the sheep important to humans?O Animals that produce human medicines could be cloned.O Cloned animals help us understand how bacteri

The guys ( jurors ) didn’t buy into science fiction

please help with this for 30 points

Even though opinions vary widely, the kingdom Protista is understood to consist of three general groups. Use your textbook (pg. 401–409) and the web sites below