gooddixk
gooddixk gooddixk
  • 02-03-2021
  • Mathematics
contestada

Find the solution to the system of equations.
You can use the interactive graph below to find the
solution.
–2x + 2y = -4
3x + 3y = -18

Respuesta :

javiercabezas1220 javiercabezas1220
  • 02-03-2021
No solution it’s infinite
Answer Link

Otras preguntas

please please please help me asap! I need to get this done!!!
helllllpppppppppp! me plz
1. Solomon says, "I have drawn a triangle. It has one angle of 30° and another angle of 40°. Adeline, you draw a triangle with the same two properties." Adeline
The side length of a square that has an area of 20cm2 is between which two values in the table?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
The circulatory system is made up of the blood, the heart, and the lungs. O True O False
"When the maese de campo arrived at the pueblo of Acoma he asked the Indians for provisions for his trip and gave them in exchange hatchets and many other thing
help me pls helpppppppppppppppppppppppppp
easy music question.................
the primary pigments contained in the epidermis are