lungilegosiame41 lungilegosiame41

04-03-2021
Mathematics

contestada

By how much is -23 less than 23?

Respuesta :

madaradhamanjari madaradhamanjari

04-03-2021

Answer:

46

Hope it helps

Please mark me as the brainliest

Thank you

Answer Link

BenMott BenMott

04-03-2021

46! I hope you have a great day :)

Answer Link

Otras preguntas

what is the theoretical probability of picking a diamond from a standard deck of car

Solve the equation. Identify any extraneous solutions. x=sqrt2x+24 6 and 4 are both extraneous solutions. 4 is a solution to the original equation. The value –6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Please someone help me with this

Find 8 + 35 + (-76).

If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

PLEASE HELP!!!!!!!! Which of the following is a continuous random variable? A) the number of employees in an office B) the salaries of employees in an off

what are the zeros of the function? f(x)=+-6x

Fractures of the blank of long bones are especially common in young animals