kayboo2 kayboo2

03-01-2017
Mathematics

contestada

Could some body help with this? Please and thank you :)

Could some body help with this Please and thank you class=

Respuesta :

babypunk420 babypunk420

03-01-2017

A = b x h / 2

Base of this triangle: 16 units

Height: 18 units

A = 16 x 18 / 2

A = 144 units^2

Answer Link

Otras preguntas

1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession

These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and

What do the tympanic membranes do for the frog?

How did the Berlin Wall change the course of the Cold War? Please Give Three Reasons How, Thank You

what played a great role in the kansan nebraska act

Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?

In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Help with geometry!!!

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ