mj3925
mj3925 mj3925
  • 03-02-2022
  • Arts
contestada

why did the cow cross the road

Respuesta :

SmileyBangtan
SmileyBangtan SmileyBangtan
  • 03-02-2022

Answer:

to get to the udder side

Explanation:

Answer Link

Otras preguntas

an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?
need help anybody know how to do this
Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en
Can you help me to find this answer, please, I need help
paul has a standard deck of cards. what is the probability he will choose a 2?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -
Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo
Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis
can someone help me please